RuthDankwah5278 RuthDankwah5278

02-01-2018
Mathematics

contestada

What is the solution set of the equation 3x^2-34x-24=0?

Respuesta :

bwilson1403 bwilson1403

02-01-2018

x= 6/17or the alternative form is 0.352941

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?

what is the most important factor that holds a gene pool of a species together and prevents speciation?

What was OPEC protesting when it imposed it's embargo?

Suppose Naomi gets a sales bonus at her place of work that gives her an extra $600 disposable income. She chooses to spend $360 and save the remaining $240. Fr

how is an error within an EMR corrected

The drawing shows the measurements in a section of a circular design how long is the radius of the circle? F. 4.3 G. 7 H. 8.7 J. 10

If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?

Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels

Which Romantic poet said, “I think I shall be among the English Poets after my death,” before dying of tuberculosis at 25? A. Lord Byron B. Samuel Coleridge