miniminion47 miniminion47
  • 02-09-2015
  • Mathematics
contestada

A=1/2bh for b
What is b?

Respuesta :

Аноним Аноним
  • 02-09-2015
A = area
1/2 = half
b = base
h = height

1/2 x base x height
Answer Link

Otras preguntas

CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Step by step directions Square root for 480
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
why did Mr Collins come to the Bennet family looking for a wife?
A light bulb converts electrical energy into electromagnetic energy is true or false?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
How do you put allele in a sentence
the temperature of a sample of matter is a measure of the ?