HermelindaDobrynski HermelindaDobrynski
  • 04-05-2015
  • History
contestada

Meetings of Federal Reserve officials occur in Boston New York Washington, D.C. Chicago

Respuesta :

HistoryGuy HistoryGuy
  • 13-05-2015
In general, official meetings of the Federal Reserve officials occurs in Washington DC, although it is possible for them to meet elsewhere, especially unofficially.
Answer Link

Otras preguntas

Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
4(3-5)=-2(8-z)-6z what is z
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What statement best describes a republic?
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
i need help with #3