RainbowDash11 RainbowDash11

03-04-2015
Mathematics

contestada

what is the whole number that is equal to 6/2

Respuesta :

karkeys02 karkeys02

03-04-2015

6/2 is equal to 3 because 6 divided by 2 equals 3

Answer Link

Bluebellsblondie Bluebellsblondie

03-04-2015

3, because you divide 6/2 in half is 3/1, and 3/1 equals 3

Answer Link

Otras preguntas

Vince chooses 3 side dishes from a total of 10 side dishes offered on the menu is how many different ways can he choose

TRUE OR FALSE HELP QUICK

Exponential Equation WITHOUT CALCULATOR

Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf

the members of an animal community are usually similar in

distillation definition chemistry

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which phrase is NOT a way to state the meaning of the expression x – 3? The difference of a number and 3 A number minus 3 A number subtracted from 3 3 less than

When did the eastern part of the Roman Empire fall?

What two molecules are produced by the light reactions and used to power the calvin cycle?