joylivengood joylivengood

03-05-2017
Geography

contestada

In Oceania and Australasia, what are some reasons native species face extinction?

Respuesta :

jackie007ll21 jackie007ll21

03-05-2017

Urban growth and mining, I'm 99% sure

Answer Link

Otras preguntas

what's the ph of citric acid

what is r in this equation? πr^2=42π

Read each verbal expression Then assign a variable and distribute

Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in

A carpenter is making a blanket chest based on an antique chest. Both chests have the shape of a rectangular prism. The length width and height of the new chest

What man made object is likely to endure long after humans have disappeared from new york city?

HELP ASAP!! Which United States' president, in addition to Eisenhower, believed the federal government should play a smaller role in the economy? A) Ford B) Ca

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?

PLEASE HELP ASAP simplify (3x^2 - 3 + 9x^3) - (4x^3 - 2x^2 + 16).x^3 - 5x^2 + 25-x^3 + x^2 + 255x^3 + 2x + 13 5x^3 + 5x^2 - 19