cheygirl1023 cheygirl1023

02-05-2017
Mathematics

contestada

simplify the polynomial (3x^2+6x+1 )+(-7x^2+2x-3)

Respuesta :

KucklePuff KucklePuff

02-05-2017

I'm not 100% on this, but my answer is -4x^2 + 8x - 2. Please let me know if this is correct. If so, give me a high five and a pat on the head.

Answer Link

Otras preguntas

What is the landing velocity of an object that is dropped from a height of 49 m?

At a school with 100 students, 37 were taking Arabic, 34 Bulgarian, and 30 Chinese. 19 students take only Arabic, 17 take only Bulgarian, and 12 take only Chine

1. How are minor parties different from major parties?

Hemophilia is a disease that causes uncontrollable bleeding. If a father has it, all of his daughters will be carriers of the disease, and about half of his son

Which seasons do u like most?Why?

Calculate the difference and enter it below -2 -7

Choose the correct placement for commas in this sentence. Basically my work here is done. Choose 1 answer: Choose 1 answer: (Choice A) A Basically\redD{,},start

Who was the majority of people who went on crusades

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Pls help math algebra Match the algebraic expressions and the algebraic equations