misskawaii21 misskawaii21

01-05-2017
Social Studies

contestada

List two reasons why a voter should vote in every election.

Respuesta :

davidkisache davidkisache

01-05-2017

It is their constitutional right
It is their way of participating in democracy

Answer Link

Kristinabrains1 Kristinabrains1

01-05-2017

dont know mabye couse there votes are important for the council and they need the votes or if thier supporting some one they need to help himor her get elected not to sure

Answer Link

Otras preguntas

Identify the vertical asymptote(s) of each function. Check all of the boxes that apply. f(x)=3x/x^2-16 Answers: x = -16 x = -4 x = 0 x = 4 x = 16

When Anne begins to think about a boy friend, someone in turn drives her to think about Peter van Daan. Who? Peter Wessel Miep de Jong Harry Goldberg

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Satellite can focus on specific latitudes using?

(50)points 5 questions!

If an employee gets potentially infectious material splashed in his eye, what should he do?

PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!

the influence of Greek and Roman culture on some Renaissance art is reflected in what

Find the length of the missing side of a right triangle if a=6 and c=11

Improved functional health can be a positive influence on which health risk/