Seudónimo Seudónimo

01-04-2022
Biology

contestada

helppp meeee please its sum about a root of plant
brainliest given

helppp meeee please its sum about a root of plant brainliest given class=

Respuesta :

ItzBabyYoda ItzBabyYoda

01-04-2022

Answer:

Terminal bud

Explanation:

Hope that helps!

Answer Link

Otras preguntas

The sterile material that is placed directly on a wound is termed the:

behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false

Joe has always believed that he is lousy at athletics. when he tried to play soccer, he was sure he would not be good at it, and indeed, he was not very adept.

Please help I'm trying to figure out 4-15 but i don't know how to.

A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle

The law of segregation states that allele pairs separate during gamete formation. How then do we have two alleles for a trait? We receive one allele from each

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Gerri says that a spider use their fangs for the same purpose that crustaceans use their claws. Alana disagrees and says that spiders use their fangs for the s

a school cafeteria makes 4 diffrent salads during the week but serves only 2 salads each day on a roating basis. salads: chicken,fruit,pasta,tuna. a student ran

Can I get some help with these questions thank you