abb8ygirtiny abb8ygirtiny

02-01-2017
Mathematics

contestada

Find the distance between the pair of points.
(-5,2) (2,-2)

Respuesta :

tayloraycock07 tayloraycock07

02-01-2017

(7,4) The x distance is 7 units and the y distance is 4 units. Hope it helps.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15

Need Help Fast 33 points please Factor x2 + 10x – 18.

Which phrase is NOT a way to state the meaning of the expression x – 3? The difference of a number and 3 A number minus 3 A number subtracted from 3 3 less than

Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.

Which of the following do scientists think will probably cause Earth's next ice age?

What is one popular pop artist or group (from today or from the past)?

What is skeletal connective tissue? Give its function

An element's atomic number is 64. How many protons would an atom of this element have?

The wealth and prosperity of mali and songhai were dependent on controlling the trade in