tjesonowski tjesonowski

02-12-2020
Mathematics

contestada

I need some help on this-

Respuesta :

8028966 8028966

02-12-2020

Answer:

It is 57

Step-by-step explanation:

I am smart

Believe me!

Balloons are smart!

Answer Link

Otras preguntas

The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa

Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Find 8 + 35 + (-76).

Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.

If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?

when she turned 18, Kaitlyn purchased 130 shares of stock A for $47 per share; 68 shares of stock B for $32 per share; 71 shares of stock C for $102 per shar

The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.

which statement is true for a career as a graphic designer?

Which phrase refers to failed businesses? a. "the withered leaves of industrial enterprise" b. "serious curtailment of income" c. "no markets for their produce"