tatiandivy tatiandivy

01-10-2020
Mathematics

contestada

Evaluate the following expression.
6 ^1

Respuesta :

Mellonlord Mellonlord

01-10-2020

Answer:

6 has the exponent of 1, meaning that 6 does not need to be multiplied by it self. So it is simpily six.

Answer Link

Otras preguntas

Please help I will choose brainiest to whoever answers this.

Factor: −22d³+33d²+33

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Use MATLAB to obtain the roots ofx^3+ 13x² + 52x + 6 = 0

what does the male duck do when the female duck is in sight?

Use the multiplier method to decrease £262 by 39%You must show your working.

ources 12. What's the area of the triangle below? Foster.edu 8 m, 6 m O A. 24 square meters O B. 96 square meters O C. 48 square meters O D. 7 square meters

Kermit's favorite iced tea is made with 151515 tea bags in every 222 liters of water. Peggy made a 121212-liter batch of iced tea with 909090 tea bags.

A CEO made a lot of mistakes in assessing the market and the competitive conditions and improperly redesigning the organization into numerous business units. Su

Which of the following is NOT correct regarding exponential function y = a*, a > 0,a CANNOT = 1 A. If 0 B. If a > 1, then the function is increasing. C.