gavy5 gavy5
  • 03-09-2020
  • Mathematics
contestada

Evaluate
6.7- (1 - 3)2 +6.4

Respuesta :

Аноним Аноним
  • 03-09-2020

Answer:

answer is 17.1

please follow me

Ver imagen Аноним
Answer Link

Otras preguntas

Describe the set of data {33, 35, 38, 44, 45, 45, 46, 46, 46, 47}. a. normal distribution c. cannot be determined b. negatively skewed d. positively skewed
Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.
Pls answer this question
Can someone Help me with that please
4 (2x-6)=10x-6. solve for x
Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?
Associating objects that elicit an undesirable response with unpleasant or negative stimuli describes the key principle of ____.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Read the following excerpt from Sandra Cisneros’s story "Mericans." “Por favor,” says the lady. “¿Un foto?” pointing to her camera. “Si.” She’s so busy taking
Rick was so successful with his sweet treats franchise that he opened several other sweet treats locations. rick could best be described as: