Gabbtijahfaca Gabbtijahfaca

04-05-2016
Health

contestada

A person who is 15 years old has a maximum heart rate of
a. 190.
b. 220.
c. 205.
d. 165.

Respuesta :

AimDogz AimDogz

04-05-2016

Maximum heart rate is 220-age therefore 220-15= 205
The answer is C

Answer Link

solovingderrick12 solovingderrick12

31-12-2018

i will go with A 190

Answer Link

Otras preguntas

For some time, the English had little interest in colonizing for what two reasons?

What is skeletal connective tissue? Give its function

There are 36 ways two dice can land: six ways for the first die and six ways for the second die. in how many of those ways does at least one of the dice show a

-( x + 4 ) = 2x + 35

Please help with geometry!!!

In "no witchcraft for sale," why are the farquars particularly happy when teddy is born?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

2. You must use headlights when driving ___________________. A. between sunset and sunrise B. in rain C. half hour after sunset and half hour before sunrise D.

Compared to citizens of other nations, americans are _______ involved in politics and community affairs and vote at ________ levels.

HR contains six red chili beans for green jellybeans and four blue jelly beans if we choose a jellybean then another jellybean without putting the first time ba