carlohillyard2053 carlohillyard2053
  • 04-04-2019
  • History
contestada

Discuss ways the economies of the upper south and the Deep South became dependent on each other and around 1860

Respuesta :

Awesomegirl2003
Awesomegirl2003 Awesomegirl2003
  • 04-04-2019

The Upper South sold and transported enslaved people to the Deep South where they needed workers. Both the Upper and Deep South grew different crops so they depended on each other for these crops.

Hope this helps !!! ^_^ !!!

Answer Link

Otras preguntas

On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Which word has the long i sound? relieve speciality society social
Is 5/7 greater than 4/6
what are 2 points on the graph for 6x-5y=25
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
Step by step directions Square root for 480
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
testosterone directly affects the