foreverleila23 foreverleila23

02-11-2018
History

contestada

Based on the sections in the reading, how does the US Bill of Rights compare with the Georgia Bill of Rights

Respuesta :

15-11-2018

That long response was unneeded , this is the answer.

The Georgia Bill of Rights discusses the same rights as the US Bill of Rights, but often in greater detail.

Answer Link

Otras preguntas

The function f(x)f(x) is a quartic function and the zeros of f(x)f(x) are -6−6, -5−5, -2−2 and 11. Assume the leading coefficient of f(x)f(x) is 11. Write the e

5/6<7/8 true or false

c(n) = -7 + 6(n - 1)

An equilateral triangle LMQ is drawn in the interior of square LMNP so that side LM is common. Find m LQP.

Omar filled his gas tank for times last week. Here are the amounts of gas he bought 1.2,13.7,5.04,14. What is the total amount of gas omar bought last week

Nicotiana attenuata is subject to damage by both generalist and specialist herbivores. The production of nicotine is not effective against one specialist, M. se

Divide the set of data into four quartiles. 4, 5, 7, 11, 12, 15, 16, 18

What is the standard deviation for a binomial distribution with p=q=1/2 and n=36

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

How can you make a high estimate for the sum of two factions in a word problem